Generation and breeding of SphK2 knockout (SphK2 ^−/−) mice

SphK2 ^−/− mice, in which exons 4~6 of the SphK2 gene were deleted using the CRISPR-Cas9 strategy, were developed following the gene knockout protocol provided by Cyagen Biomodels (Guangzhou, China). These mice were kindly obtained from Dr. Tony Wang (Fudan University). Male homozygous knockout (SphK2 ^−/−) mice and the wild-type (WT) control mice used in the experiments were obtained by breeding heterozygous (SphK2 ^+/−) mice for more than six generations. Genotyping was performed by polymerase chain reaction (PCR) by extracting tail-vein DNA from 2-week-old mice to confirm the deletion of exons 4~6 in the SphK2 gene. In brief, mouse tail-vein was cut 0.5~1-cm long, ground into powder in liquid nitrogen, and transferred into a 1.5-mL centrifuge tube. Then 200 L of lysis buffer and 5 L of proteinase K (Yeasen Biotechnology, Co., Ltd.) were added to the tube, mixed with gentle vortex, and incubated at 55 ^∘C for 3 h. After the tube was brought back to room temperature, 200 L of PL buffer and 200 L of BD buffer (Yeasen Biotechnology, Co., Ltd.) were subsequently added to the tube with vigorous shaking. The solution was separated after centrifuge at 12000 rpm for 5 min. DNA samples were carefully extracted from the bottom layer phase of the solution. After purification and column elution, the DNA samples were subjected to PCR procedures. PCR was performed using the following primer sets: forward primer: 5’-TATGGGTGTTGCCATGTGTCC-3’; and reverse primer: 5’-AGAGCAGGTCCAGAGGATGG-3’. In the WT mice, these set primers were used to amplify a fragment of approximately 1500 bp, and in case of the SphK2 ^−/− mice, a fragment of approximately 550 bp was amplified. SphK2 ^−/− mice are physiologically normal like WT mice, but smaller than age-matched normal WT mice. All mice used in the study were treated with care in accordance with protocols established by the University of South China Animal Care and Use Committee.

Cigarette smoke exposure

Eight-week-old WT and SphK2 ^−/− mice were raised in our animal facility and exposed to mixed CS in a closed environment for one hour each day. Briefly, mice were placed in an iron chamber which was connected to a Smoke Generator (Yuyan Instruments, Co., Ltd.) by the ventilation pipe. Smoke contained a tar content of 12 mg per cigarette, and the nicotine content was 2.5 mg per cigarette, which was conducted by intermittently forcing air (2 L/min) after burning cigarettes. In total, 5 mice were exposed to smoke from 5 cigarettes (1 h) each day for 5 days per week over a period of 6 months. Mice (n ═ 5) in the control group were exposed to filtered air instead of CS. Mice (n ═ 5) in the treatment group received FTY720 (5 mg/kg/day, cat #S5002, Selleck) via intraperitoneal injection or CYM-5442 (2 mg/kg/day, cat #S2878, Selleck) via intragastric administration.

Lung tissue fixation and immunohistochemical analysis

At the end of the experiments, mice were sacrificed after inhalation of isoflurane (4%), and lung tissue was collected and fixed by tracheal instillation of 4% PFA and embedded in paraffin for immunohistochemical staining. Each tissue section (5 µm) was cut and stained with Masson’s trichrome, following the standardized manufacturer’s protocols after deparaffinization. The stained blue areas around the airways were identified as subepithelial collagen deposits. The percentages of Masson-stained areas in relation to the total epithelial area and alveolar chord length were calculated using Image J software. The mean alveolar chord length was calculated as the average of the horizontal and vertical distances between the alveolar walls. In addition, fixed sections were immunohistochemically stained with an anti-alpha smooth muscle (α-SMA) antibody (1:200, AF1507, Beyotime Biotechnology, Shanghai, China).

Bronchial alveolar lavage fluid and cell collection

Bronchial alveolar lavage fluid (BALF) was collected as previously described [22]. Briefly, mice were euthanized with 4% isoflurane inhalation. The tracheas were cannulated, and the lungs were lavaged in situ with 500 µL increments of ice-cold PBS 5 to 6 times. The average liquid recovery after lavage was greater than 60%. Supernatant fluid was aliquoted into small samples and frozen at –80 ^∘C for ELISA of cytokines. The cell mass was resuspended in 500 µL PBS, isolated by centrifugation and processed for further flow cytometry.

RNA extraction and reverse transcription-polymerase chain reaction

At the designated intervals after CS exposure, mice were anesthetized and sacrificed, followed by rapid separation of the lung tissue. After washing for ice-cold 1×PBS twice to remove residual blood, the total RNA from the tissue was extracted using TRIzol ^® reagent (Thermo Fisher Scientific, Inc.), following the manufacturer’s instructions. RNA quality was analyzed under a UV spectrophotometer, followed by reverse transcription of the RNA to cDNA using the reverse transcription kit (D7168L; Beyotime Institute of Biotechnology). Using the cDNA as a template, the transcriptional level of SphK2 gene in lung tissue was measured by RT-PCR under the following conditions: an preliminary denaturation phase at 94 ^∘C for 2 min, followed by 35 cycles of denaturation at 94 ^∘C for 30 s, annealing at 55 ^∘C for 30 s and extension at 72 ^∘C for 30 s, and a final extension at 72 ^∘C for 5 min. The SphK2 gene primers were: forward, 5’TGGCTGCTTCATTGTTCTTG3’; and reverse, 5’TTCTCTACCTTTCCGCCAGA3’. PCR products were resolved in 1.2% agarose gel and electrophoresed for 20 min. The blots were visualized under a UV spectrophotometer and quantified using Quantity One 1-D analysis software (Bio-Rad, Hercules, CA, USA).

Western blotting analysis

Lung tissues were washed with ice-cold 1×PBS and then homogenized and lysed in 150 µL of protein lysis (RIPA) buffer containing 1% PMSF (ST506, Beyotime Biotechnology, Shanghai, China). Protein lysates were harvested and electrophoresed on a 10% Bis–Tris gel (Invitrogen). Following transfer to PVDF membrane (Millipore), the protein blots were blocked with 5% BSA for 1 h and incubated overnight with the primary antibodies at 4 ^∘C. The primary antibodies specific for SphK2 (A01382-1, Boster Biol. Tec.), CFTR (ab181782, Abcam, Cambridge, UK), and Nf-κB-p65 (#3036, Cell Signaling Technology, Beverly, MA, USA) were used. Subsequently, the blots were washed with TBST 3 times and then incubated with the HRP-labeled secondary antibodies for 30 min at room temperature. The immunoreactive bands were visualized by Enhanced ECL Chemiluminescent Substrate Kit (Thermo Scientific, USA).

Nf-κB activity assay

Paraffin sections of lung tissues were dewaxed with xylene, hydrated with gradient ethanol, and antigen retrieved with a solution of citrate buffer (pH 7.0–8.0) in a microwave oven. After washing with PBS for 3 times, the sections were treated with 0.2% Triton X-100 for 20 min at room temperature. Then the sections were incubated with 3% BSA for 1 h, and further incubated with anti-phospho-Nf-κB-p65 antibody (SN371, Beyotime BiotechShanghai, China) and anti-Elastin (ab21610, abcam, Cambridge, UK) at 4 ^∘C overnight. After washing with PBS for 3 times, the sections were incubated with appropriate fluorescent secondary antibody and Dapi for 2 h and 5 min, respectively. After washing with PBS for 3 times, the slides were mounted with glycerin buffer and observed using a fluorescence microscope.

ELISA analysis

The levels of IL-6, IL-33, and S1P in the collected BALF of lung samples were measured using commercial ELISA kits (PI326 and PI627, Beyotime Biotechnology, Shanghai, China; K-1900; Echelon Bioscience, USA) following the manufacturer’s instructions.

Fluorescence-activated cell sorting analysis

Cells collected from BALF were washed with red blood cell lysis buffer (pH 7.4) to remove the residual red blood cells and were counted with Trypan blue. Approximately 2×10⁵ cells of each sample were fixed immediately in 1.5% paraformaldehyde for 10 min at 4 ^∘C. The cells were then washed with 1 × PBS and stained with anti-CD45-FITC antibody (ab210184) and anti-CD11b-PE antibody (ab25175). After staining, the cells were washed twice with 1 × PBS and subjected to fluorescence-activated cell sorting analysis. Flow cytometry data were analyzed using the software FlowJo7.6 (Tree Star, Inc. Ashland, OR, USA).

Ethical statement

All mice used in this study were housed under standard laboratory and ethical conditions with reversed light-dark cycle (12-h light/12-h dark) and with food and water available ad libitum. All protocols conformed to Declaration of Helsinki principles and in accordance with protocols established by the University of South China Animal Care and Use Committee.

Statistical analysis

Data were expressed as mean ± standard error of the mean (SEM). Statistical analysis was performed with Prism GraphPad8.0 (GraphPad Software Inc., San Diego, CA, USA). Two-tailed Student’s t-test, one-way ANOVA, or two-way ANOVA, followed by Tukey’s post-hoc analyses were used to compare different groups. A P value <0.05 was considered statistically significant. Randomization and blinding strategy were used whenever possible.

SphK2 is upregulated in lung tissue of WT mice after CS exposure

Previous studies reported that the endogenous levels of S1P were highly associated with the development of COPD [23, 24]. Here, we investigated the role of SphK2, which converts sphingosine to active S1P in COPD pathogenesis. During CS exposure, the levels of SphK2 mRNA were rapidly upregulated in the lung tissue of WT mice within the first three months, followed by a peak and subsequent decline. However, the SphK2 levels remained higher than baseline after CS exposure for six months (Figure 1A and 1B). Consistently, the protein levels of SphK2 also increased continuously and remained elevated during the CS exposure (Figure 1C and 1D). After six months of CS exposure, the levels of S1P in BALF were significantly higher than in BALF of control mice or mice exposed to CS for half a month (Figure 1E), indicating that upregulation of SphK2 promoted a significant increase in S1P secretion in the lungs of mice after long-term CS exposure. Considering that smoking-induced organ injury may not be limited to the lungs in exposed to CS, we further analyzed the transcriptional changes of SphK2 expression in other organs in CS-exposed mice. CS exposure for 6 months resulted in a 2.2-fold increase in SphK2 mRNA specifically in lung tissue (Figure 1F), which was not observed in heart, liver, and kidney, indicating that the upregulation of SphK2 is highly associated with CS-induced lung injury.

Genetic deletion of SphK2 attenuates pulmonary fibrosis and alleviates CS-induced COPD-like disease

To determine the effect of SphK2 on CS-induced pulmonary injury, we generated SphK2 gene knockout (SphK2 ^−/−) mice and backcrossed with a C57 background (Figure S1 and S2). SphK2 ^−/− mice displayed lung development and normal phenotype at the baseline as shown by normal pulmonary interstitial, alveolar, and bronchial epithelium. Exposure to CS for six months led to alveolar wall defects and destruction in WT mice, but less frequently in SphK2 ^−/− mice (Figure 2A). The mean chord length is the average of the horizontal and vertical distances between the alveolar walls, therefore it is commonly used for the analysis of airspace enlargement [35, 36]. WT mice exposed to CS for six months displayed markedly increased airspace in the lung relative to that seen in normal air-treated controls (Figure 2B). By contrast, we observed less airspace enlargement and attenuated small airways fibrosis in CS-exposed SphK2 ^–/– mouse lungs (Figure 2B and 2C). In addition to airspace enlargement, increased collagen production was also observed in lungs after chronic CS exposure. In addition to attenuated fibrosis, we found that the accumulation of α-SMA positive cells around the small airways was significantly reduced in SphK2 ^−/− mice compared with those in WT mice (Figure 2D and 2E), suggesting that SphK2 deficiency attenuated the pathological fibrotic and emphysema manifestations in mice with chronic CS exposure.

CS-induced pulmonary inflammation is attenuated in SphK2 ^−/− mice

An abundance of evidence suggests the role of inflammation in the development and progression of CS-induced COPD [1, 22]. Therefore, we investigated whether SphK2 deficiency attenuated pulmonary inflammatory response following CS exposure. CS-induced infiltration of inflammatory cells in collected BALF, which was analyzed by flow cytometry. As shown in Figure 3A–3C, more than 90% of leukocytes were selected by gating with an anti-CD45 antibody. The proportions of CD45⁺CD11b⁺ subsets in leukocytes were analyzed both in CS-exposed WT mice and SphK2 ^−/− mice. The results showed that the CD45⁺CD11b⁺ subsets in BALF of SphK2 ^−/− mice (23.0%) were significantly decreased when compared with those of WT mice (51.8%). Consistent with the higher frequencies of CD45-expressing and CD11b-expressing cells observed in WT mice, the cell number and the proportion of CD45⁺CD11b⁺ subpopulations in WT mice were both significantly higher than those in SphK2 ^−/− mice (Figure 3D and 3E). Importantly, we also found that the secretion of pleiotropic cytokines such as IL-6 and IL-33, which are predominantly observed in lung tissue and lead to airway inflammation [22], was significantly reduced in the BALF of SphK2 ^−/− mice compared with the levels in the BALF of WT mice (Figure 3F and 3G), strongly suggesting a critical role of SphK2 in inducing pulmonary inflammation after chronic CS exposure.

SphK2 deficiency preserved CFTR function, which was highly associated with attenuated pulmonary fibrosis and inflammation after CS exposure

To investigate the mechanism underlying SphK2-mediated pulmonary emphysema, remodeling, and inflammation, we analyzed the effect of SphK2 deficiency on protein expression of CFTR. The absence or dysfunction of CFTR in the alveolar epithelium lining caused decreased Cl^- secretion and increased Na⁺ reabsorption, suggesting that CS-mediated COPD might be due, at least in part, to reduced CFTR activity and related cystic fibrosis and pulmonary inflammation [2, 25]. One recent finding showed that S1P is a novel regulator of CFTR activity [16]. Therefore, we determined the CFTR expression in the lung tissue of both WT and SphK2 ^−/− mice after CS exposure. Following CS exposure for two months, the protein expression of CFTR was significantly decreased in the lung tissue of WT mice (Figure 4A). Although CFTR expression and activity were also reduced in SphK2 ^−/− mice compared with those not exposed to CS, it was largely improved when compared with CS-exposed WT mice (Figure 4A and 4B). The decrease of CFTR was accompanied by a significant increase in Nf-κB-p65 activity indicated by the phosphorylation of p65 in the lung tissue of WT mice, which was also reversed by SphK2 deficiency (Figure 4A and 4C). Nf-κB activation promotes dissociation of p50/p65 heterodimers, and phosphorylation of p65 facilitates its nuclear translocation and increased nucleotide-binding and transcriptional activity. Therefore, we further determined the DNA-binding p65 expression in lung tissue of CS-exposed mice. By immunofluorescence staining, we observed that the anti-phospho-p65 fluorescence intensity overlapping with Dapi pre-stained nuclei was significantly attenuated in SphK2 ^−/− mice compared with WT mice (Figure 4D), indicating that CS-induced p65 activation and nuclear translocation were markedly suppressed by deletion of SphK2 in lung tissue. These data indicated that SphK2 deficiency might alleviate CS-induced pulmonary inflammation by rescuing the CFTR function and suppression of Nf-κB activity.

Recently, S1P was reported as a novel regulator of CFTR activity [16]. We therefore pretreated SphK2 ^−/− mice with CYM-5442, a S1P₁ agonist (2 mg/kg/day) during the CS exposure. Compared with the SphK2 ^−/− mice without CYM-5442 treatment, a significant reduction in CFTR expression and an increase in Nf-κB activity were observed in the lung tissue of SphK2 ^−/− mice (Figure 4F and 4G). Meanwhile, CYM-5442 also enhanced small airways fibrosis and pulmonary inflammation as reflected by increased infiltration of CD45⁺CD11b⁺ monocytes in the BALF (Figure 4E, 4H, and 4I). These data suggested that SphK2-mediated S1P production aggravated CS-induced experimental COPD-like disease by inhibiting pulmonary epithelial CFTR activity.

S1P signaling inhibition restored CFTR activity and alleviated pulmonary fibrosis and inflammation after chronic CS exposure

To further establish the key role of S1P in regulating CFTR activity and related COPD development, we blocked the S1P signaling by pretreating the WT mice with FTY720 (10 mg/kg/day), which belongs to a new class of immunosuppressants that inhibit S1P signaling by competitively binding with S1P receptors. After CS exposure for six months, FTY720 treatment significantly increased the expression of CFTR and reduced the phospho-Nf-κB-p65 expression (Figure 5A–5C). Increased nuclear DNA-binding p65 in lung tissue after CS exposure was also significantly reduced by the treatment of FTY720 (Figure S3), suggesting a key role of S1P in triggering CS-mediated pulmonary inflammation. After six months of CS exposure, the inhibition of S1P by FTY720 effectively prevented alveolar enlargement (Figure 5E) and reduced lung fibrosis (Figure 5D and 5F), which was reflected by a significant decrease in small airways collagen formation. Further, FTY720 treatment markedly decreased the proportion and cell number of CD45⁺CD11b⁺ subpopulations in lung tissue of CS-exposed mice (Figure 5G–5I). These data indicated that S1P signaling plays a critical role in CS-induced COPD development, suggesting that targeting SphK2, which is responsible for S1P section post-CS exposure, is an effective therapeutic strategy against COPD.

Study limitation

Mice model induced by CS is one of the classic animal models of emphysema. Although this model has been widely used in the studies related to molecular mechanisms of COPD previously, it is not exactly the same as human COPD symptoms. Human COPD is characterized by coughing, wheezing, chest tightness and shortness of breath, which are not observed in our CS-induced mice model. In addition, airway inflammation and pulmonary fibrosis are not typical symptoms in COPD patients, while lung infiltration with inflammatory cells and enhanced fibrosis were observed in mice exposed to CS for two months. In fact, COPD symptoms do not appear until severe lung injury occurs, usually lasting for years and worsening over time. In our study, CS-mediated mice model mimics the early stage of the pathological changes of COPD. Pulmonary inflammation and fibrosis may persist even after smoking cessation, but both will be attenuated during the bronchus and alveolar remodeling. Therefore, our observation indicates that the therapeutic intervention of SphK2/S1P signaling pathway may be effective in the early treatment of emphysema but may not be applicable to the research and treatment of end-stage COPD.